malS

Information for malS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3733982-3734806 - CDS bax EG11360 putative ATP-binding protein 3735126-3737156 + CDS malS EG11316 alpha-amylase 3737334-3738587 + CDS avtA EG10107 alanine-alpha-ketoisovalerate (or valine-pyruvate) transaminase; transaminase C

Reported regulatory sites for malS: Genome coordinates Source Transcription factor Transcription factor annotation 3734858-3734876 RegulonDB crp cyclic AMP receptor protein 3735033-3735042 DPInteract malT positive regulator of mal regulon 3735057-3735066 DPInteract malT positive regulator of mal regulon 3735115-3735124 DPInteract malT positive regulator of mal regulon

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.360 3734816-3734839 tctcc TGGTCGGATTTAATCATTCCAACA cctta - 0 - 3.273 3734856-3734879 tcaca AATTTGAGAGTTGAATCTCAAATC atatc crp 19 - 3.273 3734973-3734996 cgcag AAAATGTGGGGGTTATCGCAAAAT tcagc - 0 - 2.410 3734992-3735010 atcgc AAAATTCAGCCGTTTTTTG cgcga - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back