malT

Information for malT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3547713-3550106 - CDS malP EG10560 maltodextrin phosphorylase 3550718-3553423 + CDS malT EG10562 positive regulator of mal regulon 3553466-3554071 - CDS yhgJ EG12938 orf; hypothetical protein

Reported regulatory sites for malT: Genome coordinates Source Transcription factor Transcription factor annotation 3550576-3550597 DPInteract crp cyclic AMP receptor protein 3550657-3550679 PMID: 9484893 mlc putative NAGC-like transcriptional regulator

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.570 3550657-3550680 taacc ATTAATTACGAAGCGCAAAAAAAA taata mlc 23 - 2.372 3550634-3550655 agaaa GGTTTCTGGCCGACCTTATAAC catta - 0 - 1.747 3550691-3550711 tttcc TCATTTTCCACAGTGAAGTGA ttaac - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back