malX

Information for malX, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1696176-1697204 - CDS malI EG10557 repressor of malX and Y genes 1697379-1698971 + CDS malX EG10563 PTS system; maltose and glucose-specific II ABC 1698981-1700153 + CDS malY EG10564 enzyme that may degrade or block biosynthesis of endogenous mal inducer; probably aminotrasferase

Reported regulatory sites for malX: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.903 1697322-1697345 aaacg TTTTATCTTCTCGCGCAATTTACT gaatc - 0 - 0.977 1697287-1697308 gcgta ATGTGATTTATGCCTCACTAAA atttg - 0 - 0.355 1697268-1697285 tatac CCGCTATTATCGTTGCGT aatgt - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back