malZ

Information for malZ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 420210-421583 + CDS proY EG13609 proline permease transport protein 421739-423556 + CDS malZ EG10565 maltodextrin glucosidase 423561-424142 - CDS yajB EG11095 putative glycoprotein

Reported regulatory sites for malZ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.963 421612-421633 cagga GGAAATCCTGATCCGGCTATTC cgaaa - 0 REP36 (17) 2.963 421704-421725 ggcta TGGCAAGGTGATCAGATTTTCA tcaca - 0 - 2.461 421675-421695 tcctt CAGATGATGAGTGATCCTGCA ttagg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back