maoC

Information for maoC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1447100-1449373 - CDS tynA EG13140 copper amine oxidase (tyramine oxidase) 1449621-1451666 - CDS maoC EG13735 putative aldehyde dehydrogenase 1451951-1452880 + CDS ydbO EG13736 orf; hypothetical protein

Reported regulatory sites for maoC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.981 1451795-1451814 R tattt TTATAAATCATTATTTATCA gtgca - 0 - 0.981 1451704-1451723 R gcttt TTATGATTCGCGATTTAACT attag - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back