map

Information for map, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 185978-188650 - CDS glnD EG11411 protein PII; uridylyltransferase acts on regulator of glnA 188712-189506 - CDS map EG10570 methionine aminopeptidase 189874-190599 + CDS rpsB EG10901 30S ribosomal subunit protein S2

Reported regulatory sites for map: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.237 189788-189809 R ccaaa GGGCACCCCGGAATATGTGCCG atacg - 0 - 4.064 189835-189851 R aaaag TTGGGGTTATGCCTCCA cgtat - 0 - 3.614 189690-189708 R cggcg CGCTTTATACCACAAATAC gtcgt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back