marR

Information for marR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1616267-1616932 - CDS ydeB EG11637 orf; hypothetical protein 1617201-1617578 + CDS marR EG11435 multiple antibiotic resistance protein; repressor of mar operon 1617592-1617981 + CDS marA EG11434 multiple antibiotic resistance; transcriptional activator of defense systems

Reported regulatory sites for marR: Genome coordinates Source Transcription factor Transcription factor annotation 1617086-1617109 DPInteract marR multiple antibiotic resistance protein; repressor of mar operon 1617121-1617144 DPInteract marR multiple antibiotic resistance protein; repressor of mar operon 1617047-1617064 PMID: 8636021 marA multiple antibiotic resistance; transcriptional activator of defense systems 1617027-1617038 PMID: 9393706 fis site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator for transcription

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.953 1617087-1617108 tgact TATACTTGCCTGGGCAATATTA tcccc marR 22 - 6.953 1617122-1617143 aacta ATTACTTGCCAGGGCAACTAAT gtgaa marR 22 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.098 1617145-1617168 taatg TGAAAAGTACCAGCGATCTGTTCA atgaa - 0 - 5.168 1617160-1617178 cagcg ATCTGTTCAATGAAATTAT tccat - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back