mazG

Information for mazG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2906051-2907688 - CDS pyrG EG10810 CTP synthetase 2907916-2908707 - CDS mazG EG10572 orf; hypothetical protein 2908778-2909113 - CDS chpA EG11249 probable growth inhibitor; PemK-like; autoregulated

Reported regulatory sites for mazG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.434 2908708-2908728 R agacc CGCAATTTTCAGGACAATTCA atgaa - 0 - 0.242 2908749-2908765 R aactc ACTTCTATTCTGGTCAC aggtt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back