mdaB

Information for mdaB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3169895-3170227 - CDS b3027 EG13028 orf; hypothetical protein 3170546-3171127 + CDS mdaB EG12656 modulator of drug activity B 3171158-3171472 + CDS ygiN EG12657 orf; hypothetical protein

Reported regulatory sites for mdaB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.188 3170447-3170463 agact TTTGCTAAATTCGCAAA agact - 0 - 5.188 3170468-3170484 aagac TTTGCACATTTTGCTAA tttca - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.578 3170359-3170381 cggtg CGAGTAAGAATTATGAGGAATGG ctatc - 0 - 0.578 3170401-3170423 atttt CAGAAAATATTTATCCTGCATCG gtgag - 0 - 0.458 3170509-3170526 gacgt ACTATAGTCGGCAAACGT ctcac - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back