mdh

Information for mdh, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3379835-3380902 + CDS degS EG11652 protease 3380965-3381903 - CDS mdh EG10576 malate dehydrogenase 3382338-3382808 + CDS argR EG10070 repressor of arg regulon; cer-mediated site specific recombination

Reported regulatory sites for mdh: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.156 3382278-3382301 R tattg TGCATACAGATGAATTTTTATGCA aacag argR 22 - 5.156 3382149-3382172 R ctgct TAAAAGTAAATTAATTGTTATCAA attga - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.793 3381997-3382020 R acgct AAACTTGCGTGACTACACATTCTT gagat - 0 - 2.601 3382222-3382244 R aatgt TATGAAAGAGCGGGATTTTATCA aattt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back