melR

Information for melR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4335832-4338102 - CDS adiA EG11501 biodegradative arginine decarboxylase 4338298-4339206 - CDS melR EG11230 regulator of melibiose operon 4339489-4340844 + CDS melA EG10577 alpha-galactosidase

Reported regulatory sites for melR: Genome coordinates Source Transcription factor Transcription factor annotation 4339259-4339280 DPInteract crp cyclic AMP receptor protein 4339394-4339411 DPInteract melR regulator of melibiose operon 4339218-4339235 PMID: 10760178 melR regulator of melibiose operon

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.319 4339388-4339408 R gcatt CCCATAAACTCAGATCCTGCG tgaag melR crp 15 6 - 3.319 4339359-4339379 R agcag CAGTAAATCTGAGTTTATGGG aataa melR crp 15 6 - 2.155 4339419-4339440 R aatct GCAGAAAACCTCCGGCTTCCAG gttga melR 13 - 2.155 4339328-4339349 R aatta CCTGAAAAGCAGAGTTTTCGGC ctcat melR 14 - 1.889 4339220-4339235 R cataa TTCTGATATTCCAGGA aagag melR 16 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back