menA

Information for menA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4116425-4116910 - CDS menG EG11879 menaquinone biosynthesis; unknown 4117003-4117929 - CDS menA EG11880 1;4-dihydroxy-2-naphthoate --> dimethylmenaquinone 4117996-4119327 - CDS hslU EG11881 heat shock protein hslVU; ATPase subunit; homologous to chaperones

Reported regulatory sites for menA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.988 4117947-4117966 R gtttg ATGGGGCTGAAAGGCCCCAT tttta - 0 - 2.084 4117933-4117955 R ctgaa AGGCCCCATTTTTATTGGCGCGT attat - 0 - 0.907 4117972-4117987 R cgttc AATCATTTTCATCATT gtttg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back