menF

Information for menF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2375609-2377279 - CDS menD EG10579 2-oxoglutarate decarboxylase; SHCHC synthase 2377368-2378438 - CDS menF EG12362 isochorismate hydroxymutase 2; menaquinone biosynthesis 2378742-2379047 - CDS elaB EG13185 orf; hypothetical protein

Reported regulatory sites for menF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.262 2378491-2378513 R catac CCGCAATTCTACTGGCAACAACG taatg - 0 - 3.111 2378522-2378539 R cttga GCTGGCTGGCCAGTCAGC aaaca - 0 - 2.368 2378462-2378481 R ggtga TGAAGAAGCTGTCGTCCTGG gcgcg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back