mesJ

Information for mesJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 211850-212266 + CDS yaeR EG13224 orf; hypothetical protein 212331-213629 + CDS mesJ EG13220 cell cycle protein 213678-213938 - CDS yaeO EG13221 orf; hypothetical protein

Reported regulatory sites for mesJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.595 212296-212311 ggtaa CGTGCCGGGCATTGCT actgt - 0 - 0.439 212264-212287 agcag TAAGGCTTGTCATCGCCGCATTTG cccgg - 0 - 0.403 212307-212324 gggca TTGCTACTGTAAAATCGC accat - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back