metA

Information for metA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4211259-4211702 - CDS yjaB EG11207 orf; hypothetical protein 4211859-4212788 + CDS metA EG10581 homoserine transsuccinylase 4213057-4214658 + CDS aceB EG10023 malate synthase A

Reported regulatory sites for metA: Genome coordinates Source Transcription factor Transcription factor annotation 4211808-4211815 DPInteract metJ repressor of all met genes but metF 4211816-4211823 DPInteract metJ repressor of all met genes but metF 4211824-4211831 DPInteract metJ repressor of all met genes but metF 4211832-4211839 DPInteract metJ repressor of all met genes but metF 4211748-4211762 DPInteract metR regulator for metE and metH

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.059 4211813-4211834 agcta TCTGGATGTCTAAACGTATAAG cgtat metJ 22 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.077 4211835-4211855 ataag CGTATGTAGTGAGGTAATCAG gttat metJ 5 - 1.974 4211747-4211763 ttttc CTTGAAACTTTCTCACC ttcaa metR 15 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back