metC

Information for metC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3149992-3150147 - CDS b3007 - orf; hypothetical protein 3150251-3151438 + CDS metC EG10583 cystathionine beta-lyase (beta-cystathionase) 3151578-3152237 + CDS yghB EG11824 orf; hypothetical protein

Reported regulatory sites for metC: Genome coordinates Source Transcription factor Transcription factor annotation 3150217-3150224 DPInteract metJ repressor of all met genes but metF 3150225-3150232 DPInteract metJ repressor of all met genes but metF

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.829 3150214-3150235 gctag TTTAGACATCCAGACGTATAAA aacag metJ 16 - 0.807 3150158-3150177 ttgcg AAAATTTTCTGCTTTATGCC aattc - 0 - 0.148 3150174-3150196 cttta TGCCAATTCTTCAGGATGCGCCC gcgaa - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back