metE

Information for metE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4009453-4010406 - CDS metR EG10591 regulator for metE and metH 4010643-4012904 + CDS metE EG10584 tetrahydropteroyltriglutamate methyltransferase 4012721-4013719 - CDS ysgA EG14321 putative enzyme

Reported regulatory sites for metE: Genome coordinates Source Transcription factor Transcription factor annotation 4010470-4010477 DPInteract metJ repressor of all met genes but metF 4010478-4010485 DPInteract metJ repressor of all met genes but metF 4010486-4010493 DPInteract metJ repressor of all met genes but metF 4010494-4010501 DPInteract metJ repressor of all met genes but metF 4010405-4010419 DPInteract metR regulator for metE and metH 4010441-4010455 DPInteract metR regulator for metE and metH

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.313 4010466-4010481 gccaa TTATGGATGTGTAAAC atctg metJ 12 - 4.313 4010482-4010497 taaac ATCTGGACGGCTAAAA tcctt metJ 16 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.571 4010439-4010459 tttgc GCTTGAGGAATATACAGTAAC cgcca metR 15 - 1.706 4010425-4010443 ttcgg CATGAATAATTTGCGCTTG aggaa metR 3 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back