metF

Information for metF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4127415-4129847 + CDS metL EG10590 aspartokinase II and homoserine dehydrogenase II 4130196-4131086 + CDS metF EG10585 5;10-methylenetetrahydrofolate reductase 4131415-4133595 + CDS katG EG10511 catalase; hydroperoxidase HPI(I)

Reported regulatory sites for metF: Genome coordinates Source Transcription factor Transcription factor annotation 4130115-4130122 DPInteract metJ repressor of all met genes but metF 4130123-4130130 DPInteract metJ repressor of all met genes but metF 4130131-4130138 DPInteract metJ repressor of all met genes but metF 4130139-4130146 DPInteract metJ repressor of all met genes but metF 4130147-4130154 DPInteract metJ repressor of all met genes but metF 4130060-4130074 DPInteract metR regulator for metE and metH 4130040-4130054 DPInteract metR regulator for metE and metH

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.942 4130126-4130143 cttta CATCTGGACGTCTAAACG gatag metJ 18 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.942 4129899-4129917 gtttc TAATGAAATATATTGAATT atcat - 0 - 1.942 4130038-4130056 tacca TCCTGAAGTTTTTTCATCT tccct metR 15 - 1.578 4130096-4130119 tcggt TGACGCCCTTCGGCTTTTCCTTCA tcttt metJ 5 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back