metR

Information for metR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4008666-4009565 + CDS yigM EG11471 orf; hypothetical protein 4009453-4010406 - CDS metR EG10591 regulator for metE and metH 4010643-4012904 + CDS metE EG10584 tetrahydropteroyltriglutamate methyltransferase

Reported regulatory sites for metR: Genome coordinates Source Transcription factor Transcription factor annotation 4010470-4010477 DPInteract metJ repressor of all met genes but metF 4010478-4010485 DPInteract metJ repressor of all met genes but metF 4010486-4010493 DPInteract metJ repressor of all met genes but metF 4010494-4010501 DPInteract metJ repressor of all met genes but metF 4010405-4010419 DPInteract metR regulator for metE and metH 4010441-4010455 DPInteract metR regulator for metE and metH

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.223 4010477-4010494 R gattt TAGCCGTCCAGATGTTTA cacat metJ 18 - 3.689 4010550-4010565 R cggga GCTTACTGAAGTAAGT gaccg - 0 IRU16 (16)

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.745 4010598-4010619 R tatgt AAATCCTATGGATTTTGAATTT aggga - 0 IRU16 (22) 2.745 4010495-4010516 R accat AAATTTAAAAGACGAAGGATTT tagcc metJ 7 IRU16 (17)

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back