mglA

Information for mglA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2234763-2235773 - CDS mglC EG10594 methyl-galactoside transport and galactose taxis 2235789-2237309 - CDS mglA EG10592 ATP-binding component of methyl-galactoside transport and galactose taxis 2237370-2238368 - CDS mglB EG10593 galactose-binding transport protein; receptor for galactose taxis

Reported regulatory sites for mglA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.252 2237350-2237371 R gaaat AAGACTGATTGGGCGCAGTCTA ttact - 0 - - 0.983 2237317-2237339 R gcgcc CTTATTGTATGGCCAACAAGGTA aaatt - 0 - 0.772 2237334-2237351 R cagtc TATTACTGCGCCCTTATT gtatg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back