mglB

Information for mglB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2235789-2237309 - CDS mglA EG10592 ATP-binding component of methyl-galactoside transport and galactose taxis 2237370-2238368 - CDS mglB EG10593 galactose-binding transport protein; receptor for galactose taxis 2238648-2239688 - CDS galS EG10365 mgl repressor; galactose operon inducer

Reported regulatory sites for mglB: Genome coordinates Source Transcription factor Transcription factor annotation 2238638-2238653 DPInteract galR repressor of galETK operon

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.694 2238616-2238639 R ctttc AATCTGTGAGTGATTTCACAGTAT cttaa - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.334 2238446-2238465 R ttaaa AAGTGAGCTTCGGCGTTCAG taaca - 0 - 1.988 2238541-2238564 R cgtat GTAACAGTGAATAATCACTTTTGC cgagg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back