mgsA

Information for mgsA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1023694-1025748 + CDS helD EG10426 DNA helicase IV 1025780-1026247 - CDS mgsA EG12307 methylglyoxal synthase 1026334-1026996 - CDS b0964 EG13722 orf; hypothetical protein

Reported regulatory sites for mgsA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.262 1026263-1026278 R agtgc TTACAGTAATCTGTAG gaaag - 0 - 1.411 1026282-1026301 R tcggt CTTTATCTTGCAGCGATAAG tgctt - 0 - 0.319 1026309-1026332 R ctgag ATTTTTGTGCCTGTGCGCAGGCTT tttcg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back