mgtA

Information for mgtA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4463873-4464820 - CDS treR EG12202 repressor of treA;B;C 4465199-4467895 + CDS mgtA EG12525 Mg2+ transport ATPase; P-type 1 4468101-4468526 - CDS yjgF EG12524 orf; hypothetical protein

Reported regulatory sites for mgtA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.011 4465133-4465155 acctt CAGGTAAGGCTTCGCCACGCCTG aagac - 0 - 3.984 4465094-4465115 taagg CCGTGACGTTTTAACGTCCCTG ctcag - 0 - 3.875 4465025-4465040 acgcc TCTCCCTCGACGGAGA ttaaa - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back