mhpT

Information for mhpT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 373092-374105 + CDS mhpE EG13292 4-hydroxy-2-ketovalerate aldolase 374638-375894 + CDS mhpT EG13293 putative transport protein 375879-376535 + CDS yaiL EG13294 nucleoprotein/polynucleotide-associated enzyme

Reported regulatory sites for mhpT: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.090 374246-374269 atctg CGCACGACTGCCGGATGCGGCGTG aacgc - 0 REP31c (15) 4.090 374347-374370 atctg CGCACGACTGCCGGATGCGGCGTG aacgc - 0 REP31e (15) 3.577 374158-374179 tgccg GATGCGGCGTGAACGCCTTATC cggcc - 0 REP31a (22) 3.577 374461-374482 tgccg GATGCGGCGTAAACGCCTTATC cggcc - 0 REP31g (22) 3.483 374380-374400 cctta TCCGGCCTACGGGTGGCGCGA gaatt - 0 REP31e (10) 3.483 374481-374501 cctta TCCGGCCTACGGATGGCGCGG gaatt - 0 REP31g (10) 3.281 374439-374460 gcatc AGGCATCTGCGCACGACTGCCG gatgc - 0 REP31f (4) REP31g (4) 3.281 374540-374561 gcatc AGGCATCTGCACACGACTGCCG gatgc - 0 REP31h (4) REP31i (4)

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 3.34 p=0.05 2.41 p=0.1 2.01 p=0.2 1.55

Click here to go back