mioC

Information for mioC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3921372-3923261 - CDS gidA EG10375 glucose-inhibited division; chromosome replication? 3923640-3924083 - CDS mioC EG11199 initiation of chromosome replication 3924173-3924631 - CDS asnC EG10093 regulator for asnA; asnC and gidA

Reported regulatory sites for mioC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.418 3924125-3924147 R ctttt CCACAGGTAGATCCCAACGCGTT cacag - 0 - 2.341 3924154-3924173 R ccctg ATCGGCTTTTTTAATCCCAT acttt - 0 - 1.496 3924090-3924108 R atacg CCACTCTTAATAAAGGTGG cggtt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back