mltA

Information for mltA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2943058-2943864 - CDS ygdL EG13084 putative enzyme 2944103-2945200 - CDS mltA EG13085 membrane-bound lytic murein transglycosylase A 2945409-2945485 + tRNA metZ EG30062 Initiator methionine tRNAf1; triplicate gene

Reported regulatory sites for mltA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: VC ST YP EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.397 2945384-2945399 R tggat GCGCACTATACTCCGC tcgcg - 0 - 1.747 2945324-2945343 R acgga TTTGGCATGATTTTGAACAA aaaca - 0 - 0.797 2945204-2945226 R cgcct TATTTTTTAACCTGAAGAAGAGA acaat - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back