mltB

Information for mltB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2821872-2822369 - CDS ygaD EG12698 orf; hypothetical protein 2822514-2823599 - CDS mltB EG12699 membrane-bound lytic murein transglycosylase B 2823855-2824418 + CDS srlA EG10969 PTS system; glucitol/sorbitol-specific IIC component; one of two

Reported regulatory sites for mltB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.896 2823812-2823835 R ggatt TATTGTTTTATTACCAAACGGCAA cctaa - 0 - 2.896 2823757-2823780 R aaaag TGTTATTTTGATCGCAAAATGAAA gataa crp 19 - 2.397 2823732-2823752 R agata AATATTTTAATTTGAAAGTTT gaata - 0 - 1.164 2823630-2823653 R tgcgg GGCGTGATGCTTTACCATACTTGC ccctg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back