mltC

Information for mltC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3102111-3102386 + CDS yggX EG12984 orf; hypothetical protein 3102448-3103530 + CDS mltC EG12986 membrane-bound lytic murein transglycosylase C 3103684-3104988 + CDS nupG EG10664 transport of nucleosides; permease protein

Reported regulatory sites for mltC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.357 3102393-3102413 aacag TGCCGGAGCACGCCTCCGGCA acttg - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back