modE

Information for modE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 791539-793011 - CDS modF EG11677 ATP-binding component of molybdate transport system 793079-793867 - CDS modE EG13227 molybdate uptake regulatory protein 793996-794145 + CDS b0762 EG14328 orf; hypothetical protein

Reported regulatory sites for modE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.440 793930-793952 R ctaag CACAGAAAAGCACTCCCCTTTTG tgcgg - 0 - 0.862 793975-793995 R aacat GGTCAACTCCAGATATAGTCA tgaga - 0 - 0.862 793879-793899 R ttttc CGTCACAATAAGACTTTTGCC aggac - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back