modF

Information for modF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 790262-791278 - CDS galE EG10362 UDP-galactose-4-epimerase 791539-793011 - CDS modF EG11677 ATP-binding component of molybdate transport system 793079-793867 - CDS modE EG13227 molybdate uptake regulatory protein

Reported regulatory sites for modF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.998 793031-793053 R gaaac ACGTATCCCTGTCAGTAATCGCT gcaca - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back