moeA

Information for moeA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 863603-864352 - CDS moeB EG10154 molybdopterin biosynthesis 864352-865587 - CDS moeA EG10153 molybdopterin biosynthesis 865791-866756 + CDS ybiK EG12407 putative asparaginase

Reported regulatory sites for moeA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.201 865703-865724 R tactc ATTCAATTTTTGAATATAGAAA gatgg - 0 - 1.185 865609-865632 R ttttc TGACATAATAGGCAAATTCGATTT tgcct - 0 - 0.848 865731-865753 R ttgct ATAAATATCAGAATTTTTATGAA ttact - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back