mog

Information for mog, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 8238-9191 + CDS talB EG11556 transaldolase B 9306-9893 + CDS mog EG11511 required for the efficient incorporation of molybdate into molybdoproteins 9928-10494 - CDS yaaH EG11512 orf; hypothetical protein

Reported regulatory sites for mog: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.638 9201-9224 tctta GCGTGACCGGGAAGTCGGTCACGC tacct - 0 - 6.083 9273-9293 attct GTTTAACGAGACTGTTTAAAC ggaaa - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.207 9247-9268 gtctg TCACTCCCTTCGCAGTGTATCA ttctg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back