mrcA

Information for mrcA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3519610-3520416 - CDS yrfD EG12925 orf; hypothetical protein 3520485-3523061 + CDS mrcA EG10748 peptidoglycan synthetase; penicillin-binding protein 1A 3523227-3523787 - CDS yrfE EG12926 orf; hypothetical protein

Reported regulatory sites for mrcA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.444 3520442-3520459 gtctg GCTTGCCTTTATACTACC gcgcg - 0 - 3.444 3520464-3520481 cgcgc GTTTGTTTATAAACTGCC caaat - 0 - 0.857 3520421-3520440 ctctg ACGGGTATATCAATGCGTCT ggctt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back