mreC

Information for mreC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3396024-3396512 - CDS mreD EG10610 rod shape-determining protein 3396512-3397615 - CDS mreC EG10609 rod shape-determining protein 3397681-3398784 - CDS mreB EG10608 regulator of ftsI; penicillin binding protein 3; septation function

Reported regulatory sites for mreC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.941 3397646-3397669 R gcagg CAGGGGAAGTGTCTGTTTACCCTG cctgg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.935 3397616-3397631 R atacg AGAATACGCATAACTT atgaa - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back