mrp

Information for mrp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2190535-2190816 - CDS yehE EG11991 orf; hypothetical protein 2191079-2192218 - CDS mrp EG10611 putative ATPase 2192320-2194353 + CDS metG EG10586 methionine tRNA synthetase

Reported regulatory sites for mrp: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.789 2192304-2192319 R gtcat AGTAGGCATTACTTCT taata - 0 - 1.789 2192247-2192262 R aaatg TTAAGTAAGTACTTCT ctata - 0 - 1.629 2192272-2192293 R gtgaa AAGGGGTTAGATAGTACCAAAT gggaa - 0 - 0.424 2192227-2192245 R ttctc TATATTCTTCAGGTAAACT atcag - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back