msbB

Information for msbB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1935673-1937115 + CDS pykA EG10803 pyruvate kinase II; glucose stimulated 1937246-1938217 - CDS msbB EG10614 suppressor of htrB; heat shock protein 1938337-1939596 - CDS yebA EG10013 orf; hypothetical protein

Reported regulatory sites for msbB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.672 1938298-1938320 R tcgca GCCGGTACGCAGTCAGTACCGGC ttttt - 0 - 1.672 1938218-1938240 R ttttt GCCTTATCCGAAACTGGAAAAGC atgga - 0 - 0.382 1938263-1938285 R atttg GTGCGGGGCAAGTTGCGCCGCTA cacta - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back