msrA

Information for msrA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4437449-4438792 - CDS ytfL EG12512 putative transport protein 4439115-4439753 - CDS msrA EG11433 peptide methionine sulfoxide reductase 4439959-4441692 + CDS ytfM EG12513 orf; hypothetical protein

Reported regulatory sites for msrA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.580 4439943-4439958 R cgcac ATTTTCTCCTGAATAT ccttt - 0 - 2.103 4439804-4439823 R cggtg GTTATTGTGTGCAAATACGC ctctt - 0 - 1.830 4439781-4439802 R acgcc TCTTGTTACAACCTTAACCCCA atgac - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back