mtr

Information for mtr, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3301089-3302096 + CDS yhbW EG12792 putative enzyme 3302214-3303458 - CDS mtr EG10617 tryptophan-specific transport protein 3303612-3305552 - CDS deaD EG10215 inducible ATP-independent RNA helicase

Reported regulatory sites for mtr: Genome coordinates Source Transcription factor Transcription factor annotation 3303509-3303532 DPInteract trpR regulator for trp operon and aroH; trp aporepressor 3303567-3303588 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport 3303597-3303618 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport

Species with an ortholog: HI PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.155 3303511-3303530 R tcttt TGTACTCGTGTACTGGTACA gtgca trpR 20 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.313 3303548-3303566 R acagc CCCGATTTTTACCATCGGG gcttt - 0 - 1.268 3303558-3303575 R ataat ATATACAGCCCCGATTTT tacca tyrR 9 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back