nadA

Information for nadA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 780800-780875 + tRNA lysQ EG31122 Lysine tRNA 781308-782351 + CDS nadA EG10630 quinolinate synthetase; A protein 782389-783108 + CDS pnuC EG11700 required for NMN transport

Reported regulatory sites for nadA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA VC ST YP SP EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.885 780882-780904 tgtaa AAAAGCGCCCTAAAGGCGCTTTT ttgct - 0 - 4.885 781038-781060 tgtaa AAAAGCGCCCTAAAGGCGCTTTT ttgct - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.812 781215-781235 gacta TCTTGTTTAGCATATAAAACA aatta - 0 - 1.482 780930-780948 agatt CGAACCTGCAGCAGGTTTG agttg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back