nadC

Information for nadC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 117109-117549 - CDS ppdD EG12107 prelipin peptidase dependent protein 117752-118645 - CDS nadC EG11546 quinolinate phosphoribosyltransferase 118733-119284 + CDS ampD EG10041 regulates ampC

Reported regulatory sites for nadC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.268 118675-118695 R ggttc AGAGTAGCATGTTTCTACCTT atgat - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.115 118707-118728 R tgcag GATCTCCTTATATGTGGTGCTA atacc - 0 - 1.115 118650-118671 R ttatg ATTCGTTAGCTATCTGGAGTTT taaca - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back