nadE

Information for nadE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1819942-1820280 - CDS osmE EG10044 activator of ntrL gene 1820482-1821309 + CDS nadE EG10663 NAD synthetase; prefers NH3 over glutamine 1821539-1822426 + CDS b1741 EG13993 putative excinuclease subunit

Reported regulatory sites for nadE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.162 1820318-1820341 aagcc TGGAATACATTGGGCGCTTTTTCA agccc - 0 - 1.429 1820292-1820314 tcctc TTGTTTATCAGCGTGTTAGATAA gcctg - 0 - 1.429 1820424-1820446 gtcgt TTCAGTAGCAACGGGTTAGCTTT aagga - 0 - 0.465 1820384-1820400 ctgta TGACGTTTTAACCACCA ttcag - 0 -

Critical MAP values: p=0.01 5.40 p=0.05 4.29 p=0.1 3.77 p=0.2 3.19

Click here to go back