nagA

Information for nagA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 699597-700817 - CDS nagC EG10636 transcriptional repressor of nag (N-acetylglucosamine) operon 700826-701974 - CDS nagA EG10632 N-acetylglucosamine-6-phosphate deacetylase 702034-702834 - CDS nagB EG10633 glucosamine-6-phosphate deaminase

Reported regulatory sites for nagA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.065 702000-702023 R atccc TGCCCTGGCTCCTTGCTCAGGGCA atatt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back