nagB

Information for nagB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 700826-701974 - CDS nagA EG10632 N-acetylglucosamine-6-phosphate deacetylase 702034-702834 - CDS nagB EG10633 glucosamine-6-phosphate deaminase 703167-705113 + CDS nagE EG10635 PTS system; N-acetylglucosamine-specific enzyme IIABC

Reported regulatory sites for nagB: Genome coordinates Source Transcription factor Transcription factor annotation 702991-703012 DPInteract crp cyclic AMP receptor protein 703021-703043 DPInteract nagC transcriptional repressor of nag (N-acetylglucosamine) operon 702927-702949 DPInteract nagC transcriptional repressor of nag (N-acetylglucosamine) operon

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.965 702991-703012 R gtgtc TTTTGTGAGTTTTGTCACCAAA tatcg crp 22 - 6.264 703022-703042 R aaaat TTAATTCGTATCGCAAATTAA acgcg nagC 21 - 6.264 702928-702948 R aaaac TTATTTTATCATTCAAAAAAT caggt nagC 21 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.555 702950-702970 R tccct TTTACTGGCTAAACCAGAAAA cttat - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back