nagD

Information for nagD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 696736-698400 - CDS asnB EG10092 asparagine synthetase B 698797-699549 - CDS nagD EG10634 N-acetylglucosamine metabolism 699597-700817 - CDS nagC EG10636 transcriptional repressor of nag (N-acetylglucosamine) operon

Reported regulatory sites for nagD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.190 699576-699597 R aatta ATGTGCTTTTATAGTGGCGCTT attgt - 0 - 2.091 699551-699567 R gttgt CAATATTCTGGGTAGTC catga - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back