nagE

Information for nagE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 702034-702834 - CDS nagB EG10633 glucosamine-6-phosphate deaminase 703167-705113 + CDS nagE EG10635 PTS system; N-acetylglucosamine-specific enzyme IIABC 705316-706980 + CDS glnS EG10390 glutamine tRNA synthetase

Reported regulatory sites for nagE: Genome coordinates Source Transcription factor Transcription factor annotation 702991-703012 DPInteract crp cyclic AMP receptor protein 703021-703043 DPInteract nagC transcriptional repressor of nag (N-acetylglucosamine) operon 702927-702949 DPInteract nagC transcriptional repressor of nag (N-acetylglucosamine) operon

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.309 702928-702948 acctg ATTTTTTGAATGATAAAATAA gtttt nagC 21 - 6.309 703022-703042 cgcgt TTAATTTGCGATACGAATTAA atttt nagC 21 - 4.635 702991-703012 cgata TTTGGTGACAAAACTCACAAAA gacac crp 22 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.225 703051-703069 ttcac ACACTCTGTAGCAGATGAT ctaac - 0 - 3.225 703100-703118 gcagt ACAATTTGCAGCAAAATAA aaata - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back