narU

Information for narU, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1536874-1540614 - CDS narZ EG10648 cryptic nitrate reductase 2; alpha subunit 1540696-1542084 - CDS narU EG12153 nitrite extrusion protein 2 1542408-1542743 - CDS b1470 EG13781 orf; hypothetical protein

Reported regulatory sites for narU: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.213 1542248-1542270 R gcttg TTAGTTACATTTAGTAACACATA tctgg - 0 - 1.213 1542186-1542208 R tacgc TTTCTTATCTATTCTTTCAATCA gcact - 0 - 0.127 1542385-1542404 R agtga ATAAATCATCACTAATTCTA taagt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back