narZ

Information for narZ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1535333-1536877 - CDS narY EG10647 cryptic nitrate reductase 2; beta subunit 1536874-1540614 - CDS narZ EG10648 cryptic nitrate reductase 2; alpha subunit 1540696-1542084 - CDS narU EG12153 nitrite extrusion protein 2

Reported regulatory sites for narZ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.643 1540654-1540673 R tacaa CCGTGTCGCATCCGACAAGG catca - 0 REPt119 (16) 0.000 1540621-1540637 R aattc ATTCCTGGAGCAGGAGT catgt - 0 - -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back