ndk

Information for ndk, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2641149-2642303 - CDS yfgB EG12401 orf; hypothetical protein 2642453-2642884 - CDS ndk EG10650 nucleoside diphosphate kinase 2643033-2645345 - CDS pbpC EG14210 putative peptidoglycan enzyme

Reported regulatory sites for ndk: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.104 2642983-2643002 R aaact CATTTTATTTTAAAAAAATG ttacc - 0 - 1.181 2642935-2642951 R tgttg CTCATTATAATCCGCGC catct - 0 - 0.219 2642943-2642966 R aatag TCAACGGCCCTGTTGCTCATTATA atccg - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back