nfnB

Information for nfnB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 602639-603886 - CDS ybdG EG12620 putative transport 603994-604647 - CDS nfnB EG20151 oxygen-insensitive NAD(P)H nitroreductase 604741-605109 - CDS ybdF EG12619 orf; hypothetical protein

Reported regulatory sites for nfnB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.358 604658-604676 R ctggc ACGCAAAATTACTTTCACA tggag - 0 - 1.578 604721-604741 R ggcta AAGCGGAAATCTATAGCGCAT ttttc - 0 -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back