nhaA

Information for nhaA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 16751-16960 - CDS gef EG12074 Gef protein interferes with membrane function when in excess 17489-18655 + CDS nhaA EG10652 Na+/H antiporter; pH dependent 18715-19620 + CDS nhaR EG11078 transcriptional activator of nhaA

Reported regulatory sites for nhaA: Genome coordinates Source Transcription factor Transcription factor annotation 17380-17404 PMID: 9312050 nhaR transcriptional activator of nhaA 17412-17433 PMID: 9312050 nhaR transcriptional activator of nhaA 17441-17465 PMID: 9312050 nhaR transcriptional activator of nhaA

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.854 17386-17409 atagc TCGTAAAAAACGAATTATTCCTAC actat nhaR 19 - 2.797 17293-17315 cacct TAAGCTATGATTATCTAGGCTTA gggtc - 0 - 2.797 17414-17436 cacta TAATCTGATTTTAACGATGATTC gtgcg nhaR 20 - 1.402 17135-17158 cgtaa TTTTTTAATGATTTAATTATTTAA cttta - 0 - 1.402 17201-17224 gctgg ATTATTTTTGAAATATTGGCCTAA caagc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back